********************Other******************** Dear Colleagues, I have updated the PhyPA function (Phylogenetics from pairwise alignment): 1. Now it can really work with homologous sequences as long as the titin sequences (~100,000) accurately, and it does not require a lot of memory because it uses a fast/accurate anchored alignment illustrated with two sequences below: S1 NNNNNNNNNNNNNNNNAACGTTACTTNNNNNNNNNNNNGCGGATTTTNNNNNNNNNNNNNNNNNNNNN S2 NNNNNNNNNNNNNNNNAACGTTACTTNNNNNNNNNNNNGCGGATTTTNNNNNNNNNNNNNNNNNNNNN DAMBE will first find the non-overlapping highly homologous segments that I call sequence anchors (there are two such anchors above), so alignment needs to be done only for segments before, after and between the anchors. It takes little computational time to find the sequence anchors, which is obvious for anyone who have used BLAST or FASTA suites of programs. 2. The function is now available in the Mac and Linux version of DAMBE. A new version has been uploaded to http://dambe.bio.uottawa.ca/DAMBE/dambe.aspx. Please try it and you will be impressed. PS. I have also included a number of functions to automate the supermatrix approach. That is, for a set of species, you have compiled a number of file each containing a set of homologous sequences, e.g., Gene1.fas. Gene2.fas, etc. Each file may contain a subset of the species, e.g., Gene1.fas may contain 20 Gene1 sequences from 20 species, Gene2.fas may contain 15 Gene2 sequences from 15 species, and so on. You want to alignment them by MAFFT or MUSCLE (You need to download MAFFT and MUSCLE and save them on your computer so that DAMBE can use them) and then concatenate them into a single file in the form of Sp1 ACGTACGTACGTACGTACGT Sp2 ACGTACGTACGTACGTACGT Sp3 ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT... Sp4 ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT... Sp5 --------------------ACGTACGTACGTACGTACGT... Sp6 --------------------ACGTACGTACGTACGTACGT... Sp7 --------------------ACGTACGTACGTACGTACGT... Sp8 --------------------ACGTACGTACGTACGTACGT... (You need a equal-spaced font sush as courier font to see sequences above properly. It results from the first file containing four sequences, the second file containing six, with Sp3 and Sp4 present in both files) All these can be done in a few clicks. There is also a function for evaluating MAFFT and MUSCLE alignment based on the sum of all pairwise alignment scores (SP). Once you have aligned N sequence files with MAFFT or MUSCLE, you may wish to have something like this: File MAFFT_SP MUSCLE_SP Gene1.fas 1323445 1323400 Gene2.fas 1323445 1323400 ... This helps you to decide which alignment file (MAFFT-aligned or MUSCLE-aligned) you should use in assembling the final supermatrix. With the most accurate options for both, MAFFT performs a bit better than MUSCLE based on this criterion. For 100 files aligned by either MAFFT or MUSCLE, you may find about 40 MAFFT-aligned files with high PS than the corresponding MUSCLE-aligned files, about 10 MUSCLE-aligned files with high PS than MAFFT-aligned files, and the rest being equal. This function is under the 'Alignment' menu. Best Xuhua http://dambe.bio.uottawa.ca http://science.uottawa.ca/biology/people/xia-xuhua Xuhua Xia ********************PostDocs******************** Postdoctoral fellowship to study rare alleles and genes in haloarchaeal populations. University of Connecticut, Storrs, Connecticut, USA. Mentor: J. Peter Gogarten, Co-mentor: Thane Papke; Collaborators: Lilach Hadany, Uri Gophna. The hired postdoctoral fellow will engage in an international and interdisciplinary project to explore the origin, persistence and function of rare genes and alleles in haloarchaeal populations and communities. The project addresses the following questions: How do those archaeal lineages diverge and adapt to new environments? What is the role of rare genes in the adaptation process? Genes of interest include self-splicing selfish genetic elements, restriction modification and CRISPR/Cas systems, and genes encoding weakly selected and niche adapting functions. The fellow's research will (i) identify genes having limited distribution in populations from two different model genera, Haloferax and Halorubrum, using genome and meta-genome sequence data, (ii) characterize these genes through bioinformatics based approaches, to discover the evolutionary forces leading to allelic persistence and/or coexistence in populations and communities and (iii) select suitable candidates for genetic experimentation. The fellow will also have the opportunity to collaborate on other aspects of this project such as genetic engineering, growth experiments, and modeling of population dynamics. The project is led by Dr. Johann Peter Gogarten, collaborators include Drs. Lilach Hadany (Tel Aviv University), Thane Papke (University of Connecticut), and Uri Gophna (Tel Aviv University). The fellow will work at the University of Connecticut in Storrs. Candidates must have a PhD degree in relevant fields, such as evolution, bioinformatics and microbiology. Excellent written and verbal communication skills, the ability to work harmoniously in a collaborative research team, experience in genome assembly, comparative genomics, R, and scripting languages such as Perl or Python are required. Applicants should send their CV, a letter of intent describing candidate's motivation, qualifications, skills, and experience relevant to this position, and contact information for three references to gogarten@uconn.edu. The University of Connecticut is an EEO/AA employer. -- J. Peter Gogarten Board of Trustees Distinguished Professor Department of Molecular and Cell Biology & Institute for Systems Genomics 91 North Eagleville Road, Unit 3125, BPB 404 Storrs CT 06269-3125, USA Phone: 860 486 4061 (office) 860 486 1887 (lab) 860 465 6267 (cell) FAX: 860 486 4331 Email: gogarten@uconn.edu www: http://gogarten.uconn.edu/ JohannPeter Gogarten ********************PostDocs******************** Postdoc position in Amphibian Evolutionary Genomics (3 years) A postdoctoral position in amphibian evolutionary genomics is available in the group of Wies³aw Babik at the Institute of Environmental Sciences, Jagiellonian University, Kraków, Poland (http://www.molecol.eko.uj.edu.pl/en_GB/zespol/pracownicy/wieslaw-babik). The position is within the recently awarded National Science Centre (NCN) grant "Do antigen-processing genes coevolve with MHC class I genes in salamanders?" Background. Understanding the mechanisms driving evolution of the genes underlying adaptive immunity is of major scientific importance and has implications for conservation. In this project we will test whether Antigen Processing Genes (APG) coevolve with Major Histocompatibility Complex (MHC) class I genes in salamanders. Coevolution has been suggested as the ancestral vertebrate condition, potentially limiting the efficiency and flexibility of adaptive immunity. Selection pressure to remove this constraint is therefore expected in multiple evolutionary lineages. Limited information available for salamanders reveals intriguing patterns of MHC I and APG variation, making this group ideal for testing the coevolution hypothesis and providing fundamental insights into the evolution of the adaptive immunity. Job description. The postdoc will test predictions of the coevolution hypothesis. More specifically (s)he will: i) resequence the focal genes in multiple species from several families, ii) perform bioinformatics analysis of resequencing data, iii) test for correlation between APG and MHC variation iv) look for signatures of adaptive evolution. (S)he will work together with the PI and other team members, including a network of international collaborators. Requirements. The suitable candidate will have a PhD degree obtained not earlier than in 2010 (extensions for parental leave apply), be fluent in English and have strong interest in evolutionary genomics. The candidate should have Linux/scripting language skills, experience in bioinformatics analysis of DNA sequence data and background in population genetics; background in molecular evolution will be an advantage. Employment: full time research-only for three years. Salary: ca. 6500 PLN gross (before tax, includes benefits). How to apply. For informal enquiries email wieslaw.babik@uj.edu.pl. The application (a single pdf file) should include: statement of research interests, CV with the list of publications, contact information for two referees and scan of the PhD certificate. Please send the application by email to: wieslaw.babik@uj.edu.pl no later than August 31st 2017. Selected candidates will be invited for live or Skype interviews. Preferred start date November-December 2017. Wieslaw Babik Institute of Environmental Sciences Jagiellonian University Gronostajowa 7 30-387 Kraków Poland tel. +48 12 664 51 71 fax. +48 12 664 69 12 www: http://www.molecol.eko.uj.edu.pl/en_GB/zespol/pracownicy/wieslaw-babik Wieslaw Babik